Assay design for Universal Probe Library (discontinued service)

This application was built to replace a certain "Assay Design Center" which has been discontinued from the end of 2020 by its maintainers. We hope you will find the functionality of this tool to be similar to the original, and that it allows for the continued use of your Universal Probe Library products.

Enter FASTA DNA sequence(s)

(multiple sequences accepted)

e.g.
>part of X00351 Human mRNA for beta-actin
CACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGA
GGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGA
CCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTG
ATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCC

Optional parameters (defaults recommended) Primer3 input parameters

Primer length (nt)

Optimum Min Max

Amplicon length (nt)

Min Max

Melting temperate (°C)

Optimum Min Max

Annealing properties

GC min % GC clamp Self-dimer (any) Self-dimer (3')